A general method for genotyping mast cell-deficient KITW/KITWυ mice by allele-specific polymerase chain reaction

M. Laig-Webster, Lisa Coussens, D. Hanahan, G. H. Caughey

Research output: Contribution to journalArticle

2 Citations (Scopus)

Abstract

In crossing standard C57BL6J-KitW-υ (Black) and WB/ReJ-KitW (White) heterozygotes to create the mast cell-deficient compound heterozygotes KitW / KitW-υ, coat color distinguishes the 4 possible genotypes. However, in many customized crosses into different strain backgrounds, coat color is not an indicator of genotype. To facilitate such crosses, we developed a PCR-based approach to identify KITW and KITW-υ single and compound heterozygotes. In this approach, the KITW and KITW-υ mutations are amplified but not normal DNA. DNA from 2-mm mouse tails is proteinase K digested and boiled in 0.5 ml. To trace the KITW mutation, we use primers for introns 9 and 10 of the mouse kit gene (CCAAGAGAAAGCTTTGTTCCCTGAATGTGC and AGAACAATTCAATGCTCAT). To trace the KITW-υ mutation, we use primers for exons 12 and 13 (CATTGGGAGCTGGTGCCTTCGGGAAGGT and AGACTACCTCCCACCA). 3 μl tail DNA are amplified with 2.5 U AmpliTaq Gold in a 50-μl reaction containing 10 pmol of each primer, 200 μM dNTPs and 1.5 mM MgCl2. The KITW mutation is detected by 1 cycle at 94°C for 5 min, 20 cycles at 94°C for 30 sec and 72°C for 1 min, 40 cycles at 94°C for 30 sec, 58°C for 1 min and 72°C for 30 sec. The KITW-υ mutation is detected by 1 cycle at 94°C for 5 min, 10 cycles at 94°C for 30 sec and 72°C for 1 min, 50 cycles at 94°C for 30 sec, 51°C for 1 min and 72°C for 30 sec. PCR results were verified by DNA sequencing. This assay is applicable to any experiment requiring KitW / KitW-υ genotyping.

Original languageEnglish (US)
JournalFASEB Journal
Volume12
Issue number5
StatePublished - Mar 20 1998
Externally publishedYes

Fingerprint

Polymerase chain reaction
mast cells
Mast Cells
genotyping
polymerase chain reaction
Alleles
alleles
mutation
Polymerase Chain Reaction
Heterozygote
Mutation
DNA
mice
heterozygosity
Tail
Color
tail
Endopeptidase K
Magnesium Chloride
Genotype

ASJC Scopus subject areas

  • Agricultural and Biological Sciences (miscellaneous)
  • Biochemistry, Genetics and Molecular Biology(all)
  • Biochemistry
  • Cell Biology

Cite this

A general method for genotyping mast cell-deficient KITW/KITWυ mice by allele-specific polymerase chain reaction. / Laig-Webster, M.; Coussens, Lisa; Hanahan, D.; Caughey, G. H.

In: FASEB Journal, Vol. 12, No. 5, 20.03.1998.

Research output: Contribution to journalArticle

@article{41e278d86f2545f4b5f96b1a8080083d,
title = "A general method for genotyping mast cell-deficient KITW/KITWυ mice by allele-specific polymerase chain reaction",
abstract = "In crossing standard C57BL6J-KitW-υ (Black) and WB/ReJ-KitW (White) heterozygotes to create the mast cell-deficient compound heterozygotes KitW / KitW-υ, coat color distinguishes the 4 possible genotypes. However, in many customized crosses into different strain backgrounds, coat color is not an indicator of genotype. To facilitate such crosses, we developed a PCR-based approach to identify KITW and KITW-υ single and compound heterozygotes. In this approach, the KITW and KITW-υ mutations are amplified but not normal DNA. DNA from 2-mm mouse tails is proteinase K digested and boiled in 0.5 ml. To trace the KITW mutation, we use primers for introns 9 and 10 of the mouse kit gene (CCAAGAGAAAGCTTTGTTCCCTGAATGTGC and AGAACAATTCAATGCTCAT). To trace the KITW-υ mutation, we use primers for exons 12 and 13 (CATTGGGAGCTGGTGCCTTCGGGAAGGT and AGACTACCTCCCACCA). 3 μl tail DNA are amplified with 2.5 U AmpliTaq Gold in a 50-μl reaction containing 10 pmol of each primer, 200 μM dNTPs and 1.5 mM MgCl2. The KITW mutation is detected by 1 cycle at 94°C for 5 min, 20 cycles at 94°C for 30 sec and 72°C for 1 min, 40 cycles at 94°C for 30 sec, 58°C for 1 min and 72°C for 30 sec. The KITW-υ mutation is detected by 1 cycle at 94°C for 5 min, 10 cycles at 94°C for 30 sec and 72°C for 1 min, 50 cycles at 94°C for 30 sec, 51°C for 1 min and 72°C for 30 sec. PCR results were verified by DNA sequencing. This assay is applicable to any experiment requiring KitW / KitW-υ genotyping.",
author = "M. Laig-Webster and Lisa Coussens and D. Hanahan and Caughey, {G. H.}",
year = "1998",
month = "3",
day = "20",
language = "English (US)",
volume = "12",
journal = "FASEB Journal",
issn = "0892-6638",
publisher = "FASEB",
number = "5",

}

TY - JOUR

T1 - A general method for genotyping mast cell-deficient KITW/KITWυ mice by allele-specific polymerase chain reaction

AU - Laig-Webster, M.

AU - Coussens, Lisa

AU - Hanahan, D.

AU - Caughey, G. H.

PY - 1998/3/20

Y1 - 1998/3/20

N2 - In crossing standard C57BL6J-KitW-υ (Black) and WB/ReJ-KitW (White) heterozygotes to create the mast cell-deficient compound heterozygotes KitW / KitW-υ, coat color distinguishes the 4 possible genotypes. However, in many customized crosses into different strain backgrounds, coat color is not an indicator of genotype. To facilitate such crosses, we developed a PCR-based approach to identify KITW and KITW-υ single and compound heterozygotes. In this approach, the KITW and KITW-υ mutations are amplified but not normal DNA. DNA from 2-mm mouse tails is proteinase K digested and boiled in 0.5 ml. To trace the KITW mutation, we use primers for introns 9 and 10 of the mouse kit gene (CCAAGAGAAAGCTTTGTTCCCTGAATGTGC and AGAACAATTCAATGCTCAT). To trace the KITW-υ mutation, we use primers for exons 12 and 13 (CATTGGGAGCTGGTGCCTTCGGGAAGGT and AGACTACCTCCCACCA). 3 μl tail DNA are amplified with 2.5 U AmpliTaq Gold in a 50-μl reaction containing 10 pmol of each primer, 200 μM dNTPs and 1.5 mM MgCl2. The KITW mutation is detected by 1 cycle at 94°C for 5 min, 20 cycles at 94°C for 30 sec and 72°C for 1 min, 40 cycles at 94°C for 30 sec, 58°C for 1 min and 72°C for 30 sec. The KITW-υ mutation is detected by 1 cycle at 94°C for 5 min, 10 cycles at 94°C for 30 sec and 72°C for 1 min, 50 cycles at 94°C for 30 sec, 51°C for 1 min and 72°C for 30 sec. PCR results were verified by DNA sequencing. This assay is applicable to any experiment requiring KitW / KitW-υ genotyping.

AB - In crossing standard C57BL6J-KitW-υ (Black) and WB/ReJ-KitW (White) heterozygotes to create the mast cell-deficient compound heterozygotes KitW / KitW-υ, coat color distinguishes the 4 possible genotypes. However, in many customized crosses into different strain backgrounds, coat color is not an indicator of genotype. To facilitate such crosses, we developed a PCR-based approach to identify KITW and KITW-υ single and compound heterozygotes. In this approach, the KITW and KITW-υ mutations are amplified but not normal DNA. DNA from 2-mm mouse tails is proteinase K digested and boiled in 0.5 ml. To trace the KITW mutation, we use primers for introns 9 and 10 of the mouse kit gene (CCAAGAGAAAGCTTTGTTCCCTGAATGTGC and AGAACAATTCAATGCTCAT). To trace the KITW-υ mutation, we use primers for exons 12 and 13 (CATTGGGAGCTGGTGCCTTCGGGAAGGT and AGACTACCTCCCACCA). 3 μl tail DNA are amplified with 2.5 U AmpliTaq Gold in a 50-μl reaction containing 10 pmol of each primer, 200 μM dNTPs and 1.5 mM MgCl2. The KITW mutation is detected by 1 cycle at 94°C for 5 min, 20 cycles at 94°C for 30 sec and 72°C for 1 min, 40 cycles at 94°C for 30 sec, 58°C for 1 min and 72°C for 30 sec. The KITW-υ mutation is detected by 1 cycle at 94°C for 5 min, 10 cycles at 94°C for 30 sec and 72°C for 1 min, 50 cycles at 94°C for 30 sec, 51°C for 1 min and 72°C for 30 sec. PCR results were verified by DNA sequencing. This assay is applicable to any experiment requiring KitW / KitW-υ genotyping.

UR - http://www.scopus.com/inward/record.url?scp=26744457912&partnerID=8YFLogxK

UR - http://www.scopus.com/inward/citedby.url?scp=26744457912&partnerID=8YFLogxK

M3 - Article

VL - 12

JO - FASEB Journal

JF - FASEB Journal

SN - 0892-6638

IS - 5

ER -